Transcript: Human NM_001370194.1

Homo sapiens immunoglobulin binding protein 1 (IGBP1), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
IGBP1 (3476)
Length:
1100
CDS:
14..757

Additional Resources:

NCBI RefSeq record:
NM_001370194.1
NBCI Gene record:
IGBP1 (3476)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001370194.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000039967 CTCGACTTGTTCAGCCGAAAT pLKO.1 188 CDS 100% 10.800 15.120 N IGBP1 n/a
2 TRCN0000039966 GCATCTCAAAGACAGGCTAAA pLKO.1 467 CDS 100% 10.800 7.560 N IGBP1 n/a
3 TRCN0000288669 GCATCTCAAAGACAGGCTAAA pLKO_005 467 CDS 100% 10.800 7.560 N IGBP1 n/a
4 TRCN0000010293 GACAGTTACTGGACGAAGTAG pLKO.1 72 CDS 100% 4.950 3.465 N IGBP1 n/a
5 TRCN0000295827 GACAGTTACTGGACGAAGTAG pLKO_005 72 CDS 100% 4.950 3.465 N IGBP1 n/a
6 TRCN0000039965 GCTCAGCAACAGGAAGAACAA pLKO.1 626 CDS 100% 4.950 3.465 N IGBP1 n/a
7 TRCN0000288610 GCTCAGCAACAGGAAGAACAA pLKO_005 626 CDS 100% 4.950 3.465 N IGBP1 n/a
8 TRCN0000039963 GTCAAGTGATTAAGTGTGTAT pLKO.1 900 3UTR 100% 4.950 3.465 N IGBP1 n/a
9 TRCN0000010295 TGCTTCAGCTCTGTACAACGA pLKO.1 840 3UTR 100% 2.640 1.848 N IGBP1 n/a
10 TRCN0000295883 TGCTTCAGCTCTGTACAACGA pLKO_005 840 3UTR 100% 2.640 1.848 N IGBP1 n/a
11 TRCN0000010294 CAACTATGACGGTGAGTGACT pLKO.1 525 CDS 100% 2.640 1.320 Y IGBP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001370194.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.