Transcript: Human NM_001370210.1

Homo sapiens synaptotagmin 7 (SYT7), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-07-07
Taxon:
Homo sapiens (human)
Gene:
SYT7 (9066)
Length:
2547
CDS:
164..1603

Additional Resources:

NCBI RefSeq record:
NM_001370210.1
NBCI Gene record:
SYT7 (9066)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001370210.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000379744 TCAAAGCCCGGAACCTCAAAG pLKO_005 1314 CDS 100% 10.800 7.560 N SYT7 n/a
2 TRCN0000007971 GCTCACCGTGAAGATCATGAA pLKO.1 904 CDS 100% 4.950 3.465 N SYT7 n/a
3 TRCN0000318760 GCTCACCGTGAAGATCATGAA pLKO_005 904 CDS 100% 4.950 3.465 N SYT7 n/a
4 TRCN0000007968 GACGATGAAGAGGAACCTGAA pLKO.1 1420 CDS 100% 4.050 2.835 N SYT7 n/a
5 TRCN0000318761 GACGATGAAGAGGAACCTGAA pLKO_005 1420 CDS 100% 4.050 2.835 N SYT7 n/a
6 TRCN0000007969 GAACATCATCAAAGCCCGGAA pLKO.1 1306 CDS 100% 2.160 1.512 N SYT7 n/a
7 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 2164 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001370210.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.