Transcript: Human NM_001370212.1

Homo sapiens zinc finger protein 362 (ZNF362), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
ZNF362 (149076)
Length:
3818
CDS:
883..2145

Additional Resources:

NCBI RefSeq record:
NM_001370212.1
NBCI Gene record:
ZNF362 (149076)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001370212.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000238488 CGCCATTGATTTACCAGTTTA pLKO_005 3354 3UTR 100% 13.200 18.480 N Zfp362 n/a
2 TRCN0000344954 GATGGCCGAGCCTCGATTTAA pLKO_005 921 CDS 100% 15.000 12.000 N ZNF362 n/a
3 TRCN0000107765 CCCTGTAAATACGCTGTTATA pLKO.1 3486 3UTR 100% 13.200 9.240 N ZNF362 n/a
4 TRCN0000107768 CAACCTGGTTCTGATTAACAA pLKO.1 990 CDS 100% 5.625 3.938 N ZNF362 n/a
5 TRCN0000333839 CAACCTGGTTCTGATTAACAA pLKO_005 990 CDS 100% 5.625 3.938 N ZNF362 n/a
6 TRCN0000107767 CTATTCGGACTCCGCTTCTTT pLKO.1 1929 CDS 100% 5.625 3.938 N ZNF362 n/a
7 TRCN0000107769 CCCGGTGCGAATCTCTCTCAT pLKO.1 2121 CDS 100% 1.650 1.155 N ZNF362 n/a
8 TRCN0000333759 CCCGGTGCGAATCTCTCTCAT pLKO_005 2121 CDS 100% 1.650 1.155 N ZNF362 n/a
9 TRCN0000107766 CCACTGCTCCTACTGTGATAA pLKO.1 1731 CDS 100% 13.200 7.920 N ZNF362 n/a
10 TRCN0000333758 CCACTGCTCCTACTGTGATAA pLKO_005 1731 CDS 100% 13.200 7.920 N ZNF362 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001370212.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.