Transcript: Human NM_001370285.1

Homo sapiens DNA helicase B (HELB), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
HELB (92797)
Length:
3472
CDS:
112..3375

Additional Resources:

NCBI RefSeq record:
NM_001370285.1
NBCI Gene record:
HELB (92797)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001370285.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000153633 CCGCGTTTCTATTTGTGATGA pLKO.1 294 CDS 100% 4.950 6.930 N HELB n/a
2 TRCN0000157343 CGAGGAGCAAACAGTTGTCTA pLKO.1 2787 CDS 100% 4.950 6.930 N HELB n/a
3 TRCN0000151286 CGCGTTTCTATTTGTGATGAA pLKO.1 295 CDS 100% 4.950 6.930 N HELB n/a
4 TRCN0000151876 CGTGACTTTGAAAGTAACGTT pLKO.1 2581 CDS 100% 3.000 4.200 N HELB n/a
5 TRCN0000152703 GCTGGCTTACTAAGACAGAAA pLKO.1 1741 CDS 100% 4.950 3.960 N HELB n/a
6 TRCN0000152487 CCTTGGCATTTATGTGTCGAT pLKO.1 1234 CDS 100% 2.640 2.112 N HELB n/a
7 TRCN0000153803 CAGGACAATGGTGACCATATT pLKO.1 1375 CDS 100% 13.200 9.240 N HELB n/a
8 TRCN0000152488 CCTGGTAACTTGCTGAAAGAT pLKO.1 1999 CDS 100% 5.625 3.938 N HELB n/a
9 TRCN0000153044 GAACCTGGTAACTTGCTGAAA pLKO.1 1996 CDS 100% 4.950 3.465 N HELB n/a
10 TRCN0000152896 GTCTGATATGTCACCACCAAA pLKO.1 456 CDS 100% 4.950 3.465 N HELB n/a
11 TRCN0000152634 GTTAGAGTTCTGGTTGTGGAT pLKO.1 1861 CDS 100% 2.640 1.848 N HELB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001370285.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.