Transcript: Human NM_001370348.2

Homo sapiens PHD finger protein 3 (PHF3), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
PHF3 (23469)
Length:
18797
CDS:
375..6494

Additional Resources:

NCBI RefSeq record:
NM_001370348.2
NBCI Gene record:
PHF3 (23469)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001370348.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000238713 TGTTGGTCTTGACGATATTAT pLKO_005 620 CDS 100% 15.000 21.000 N Phf3 n/a
2 TRCN0000238712 CACTTAGATGATGCCCTATTT pLKO_005 417 CDS 100% 13.200 18.480 N Phf3 n/a
3 TRCN0000019116 CCTCGTTTAATGGCACAAGAA pLKO.1 762 CDS 100% 4.950 6.930 N PHF3 n/a
4 TRCN0000019114 CGCCAATAAGTCATTGGAGAA pLKO.1 3614 CDS 100% 0.405 0.567 N PHF3 n/a
5 TRCN0000274376 ATCTATTGTTGGGCTTAATTA pLKO_005 4393 CDS 100% 15.000 10.500 N PHF3 n/a
6 TRCN0000019118 GCAACTGGATAGGCCATTTAA pLKO.1 6095 CDS 100% 15.000 10.500 N PHF3 n/a
7 TRCN0000274413 GCAACTGGATAGGCCATTTAA pLKO_005 6095 CDS 100% 15.000 10.500 N PHF3 n/a
8 TRCN0000019117 GCAGCAAAGTATGAAGTAATA pLKO.1 1905 CDS 100% 13.200 9.240 N PHF3 n/a
9 TRCN0000274375 GCAGCAAAGTATGAAGTAATA pLKO_005 1905 CDS 100% 13.200 9.240 N PHF3 n/a
10 TRCN0000019115 CCAGTCAAGTAGCGTTTCTTA pLKO.1 1793 CDS 100% 5.625 3.938 N PHF3 n/a
11 TRCN0000274412 CCAGTCAAGTAGCGTTTCTTA pLKO_005 1793 CDS 100% 5.625 3.938 N PHF3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001370348.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.