Transcript: Human NM_001370401.1

Homo sapiens RAB11 family interacting protein 3 (RAB11FIP3), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-06-24
Taxon:
Homo sapiens (human)
Gene:
RAB11FIP3 (9727)
Length:
4936
CDS:
359..2764

Additional Resources:

NCBI RefSeq record:
NM_001370401.1
NBCI Gene record:
RAB11FIP3 (9727)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001370401.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000056477 GCAGGTGAAGGACTTAACTAA pLKO.1 1069 CDS 100% 5.625 7.875 N RAB11FIP3 n/a
2 TRCN0000423236 CATTGCTGACAAGGTTGTCTT pLKO_005 1876 CDS 100% 4.950 6.930 N RAB11FIP3 n/a
3 TRCN0000056476 CACTTTGAGGACTACGGTGAA pLKO.1 1523 CDS 100% 4.050 5.670 N RAB11FIP3 n/a
4 TRCN0000056475 GCAGGACTACATCGACAGGAT pLKO.1 2695 CDS 100% 2.640 2.112 N RAB11FIP3 n/a
5 TRCN0000421983 GGGATCACAGCCATCAGAAAC pLKO_005 1142 CDS 100% 10.800 7.560 N RAB11FIP3 n/a
6 TRCN0000056473 GCAGAAGCTGTTGGATGAGAT pLKO.1 2221 CDS 100% 4.950 3.465 N RAB11FIP3 n/a
7 TRCN0000056474 CATCCAGTTTGCTACGGTCTA pLKO.1 1039 CDS 100% 4.050 2.835 N RAB11FIP3 n/a
8 TRCN0000187717 GAAGAGCATTGAGATCGAGAA pLKO.1 2101 CDS 100% 4.050 2.835 N Rab11fip3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001370401.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.