Transcript: Human NM_001370425.1

Homo sapiens A-kinase anchoring protein 1 (AKAP1), transcript variant 6, mRNA.

Source:
NCBI, updated 2019-05-14
Taxon:
Homo sapiens (human)
Gene:
AKAP1 (8165)
Length:
4092
CDS:
361..3072

Additional Resources:

NCBI RefSeq record:
NM_001370425.1
NBCI Gene record:
AKAP1 (8165)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001370425.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000329837 CGTGGACTACGGCGGATATAA pLKO_005 2739 CDS 100% 15.000 21.000 N AKAP1 n/a
2 TRCN0000329914 CACTTAGTCGGTCGGCTAATT pLKO_005 2209 CDS 100% 13.200 18.480 N AKAP1 n/a
3 TRCN0000380464 AGAGCTGAACCTCACCAATAT pLKO_005 2388 CDS 100% 13.200 9.240 N AKAP1 n/a
4 TRCN0000329836 CAAAGATGAACATCGGAATAA pLKO_005 3135 3UTR 100% 13.200 9.240 N AKAP1 n/a
5 TRCN0000381843 GGATGCGGAAGCAGATCATTC pLKO_005 2049 CDS 100% 10.800 7.560 N AKAP1 n/a
6 TRCN0000013162 CCAACTGGTCTTCCTCTGATT pLKO.1 2950 CDS 100% 4.950 3.465 N AKAP1 n/a
7 TRCN0000013160 CGGCAAATCAGGTCTGACTTT pLKO.1 2782 CDS 100% 4.950 3.465 N AKAP1 n/a
8 TRCN0000013159 GCTCAGATTCTTTCAGCACTT pLKO.1 1880 CDS 100% 4.050 2.835 N AKAP1 n/a
9 TRCN0000329913 GCTCAGATTCTTTCAGCACTT pLKO_005 1880 CDS 100% 4.050 2.835 N AKAP1 n/a
10 TRCN0000013161 CCCAAGTGATCTCAGAAGCAA pLKO.1 1418 CDS 100% 3.000 2.100 N AKAP1 n/a
11 TRCN0000329912 CCCAAGTGATCTCAGAAGCAA pLKO_005 1418 CDS 100% 3.000 2.100 N AKAP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001370425.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.