Transcript: Human NM_001370554.1

Homo sapiens regulatory factor X7 (RFX7), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-05-10
Taxon:
Homo sapiens (human)
Gene:
RFX7 (64864)
Length:
4262
CDS:
229..4074

Additional Resources:

NCBI RefSeq record:
NM_001370554.1
NBCI Gene record:
RFX7 (64864)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001370554.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000236594 TAGCACCGGTCAGATCAATTT pLKO_005 3900 CDS 100% 13.200 18.480 N RFX7 n/a
2 TRCN0000236592 TCTAATATCCCACGATCTAAT pLKO_005 3493 CDS 100% 13.200 18.480 N RFX7 n/a
3 TRCN0000236593 TCTTGGTTACCATCCATTAAG pLKO_005 354 CDS 100% 13.200 18.480 N RFX7 n/a
4 TRCN0000236591 CAATCAATAAAGACCCTAAAT pLKO_005 1868 CDS 100% 13.200 10.560 N RFX7 n/a
5 TRCN0000136249 GCAGCAAATGTCAATGAACAA pLKO.1 2622 CDS 100% 4.950 3.960 N RFX7 n/a
6 TRCN0000135621 GCAGCTTTAATCCAAATGGAT pLKO.1 2261 CDS 100% 3.000 2.400 N RFX7 n/a
7 TRCN0000135280 CCCTCTATCCAGTATCTAATA pLKO.1 3479 CDS 100% 13.200 9.240 N RFX7 n/a
8 TRCN0000135841 CCAACAACATAGCTCAAAGAA pLKO.1 3584 CDS 100% 5.625 3.938 N RFX7 n/a
9 TRCN0000136157 GTTGTGAACAACAGCAAGATA pLKO.1 2321 CDS 100% 5.625 3.938 N RFX7 n/a
10 TRCN0000137675 GCCCAGAAAGTGTTAAGCCAA pLKO.1 625 CDS 100% 2.640 1.848 N RFX7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001370554.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.