Transcript: Human NM_001370730.1

Homo sapiens speckle type BTB/POZ protein (SPOP), transcript variant 7, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
SPOP (8405)
Length:
3139
CDS:
521..1645

Additional Resources:

NCBI RefSeq record:
NM_001370730.1
NBCI Gene record:
SPOP (8405)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001370730.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000139400 CAAAGAGTGAAGTTCGGGCAA pLKO.1 801 CDS 100% 2.160 3.024 N SPOP n/a
2 TRCN0000139181 CACAAGGCTATCTTAGCAGCT pLKO.1 1160 CDS 100% 2.160 3.024 N SPOP n/a
3 TRCN0000343155 CACAAGGCTATCTTAGCAGCT pLKO_005 1160 CDS 100% 2.160 3.024 N SPOP n/a
4 TRCN0000139811 CAAACGCCTGAAGCAATCCTA pLKO.1 1624 CDS 100% 3.000 2.400 N SPOP n/a
5 TRCN0000140201 GCGCTTAAAGGTCATGTGTGA pLKO.1 1369 CDS 100% 2.640 2.112 N SPOP n/a
6 TRCN0000144406 CACAGATCAAGGTAGTGAAAT pLKO.1 594 CDS 100% 13.200 9.240 N SPOP n/a
7 TRCN0000343089 CACAGATCAAGGTAGTGAAAT pLKO_005 594 CDS 100% 13.200 9.240 N SPOP n/a
8 TRCN0000366282 GAAATGGTGTTTGCGAGTAAA pLKO_005 715 CDS 100% 13.200 9.240 N Spop n/a
9 TRCN0000145024 GCAGTGGATTTCATCAACTAT pLKO.1 1481 CDS 100% 5.625 3.938 N SPOP n/a
10 TRCN0000139043 CTCCTACATGTGGACCATCAA pLKO.1 616 CDS 100% 4.950 3.465 N SPOP n/a
11 TRCN0000343090 CTCCTACATGTGGACCATCAA pLKO_005 616 CDS 100% 4.950 3.465 N SPOP n/a
12 TRCN0000140431 GAGGTGAGTGTTGTGCAAGAT pLKO.1 998 CDS 100% 4.950 3.465 N SPOP n/a
13 TRCN0000343091 GAGGTGAGTGTTGTGCAAGAT pLKO_005 998 CDS 100% 4.950 3.465 N SPOP n/a
14 TRCN0000139794 CAGATGAGTTAGGAGGACTGT pLKO.1 1080 CDS 100% 2.640 1.848 N SPOP n/a
15 TRCN0000122224 GATTCAAGAAATTCATCCGTA pLKO.1 915 CDS 100% 2.640 1.848 N SPOP n/a
16 TRCN0000122127 GAATACCATGAACATGGTAAA pLKO.1 1039 CDS 100% 1.080 0.756 N SPOP n/a
17 TRCN0000374850 TGTGGACCATCAATAACTTTA pLKO_005 624 CDS 100% 13.200 7.920 N Spop n/a
18 TRCN0000145047 CAAGGTAGTGAAATTCTCCTA pLKO.1 601 CDS 100% 2.640 1.584 N SPOP n/a
19 TRCN0000165027 GAACTCCTGACCTCAAGTGAT pLKO.1 158 5UTR 100% 4.950 2.475 Y LOC387873 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001370730.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.