Transcript: Human NM_001370766.1

Homo sapiens RAD54 like (RAD54L), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
RAD54L (8438)
Length:
2491
CDS:
597..2300

Additional Resources:

NCBI RefSeq record:
NM_001370766.1
NBCI Gene record:
RAD54L (8438)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001370766.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000418537 TGGTCTGGGTGTAGCTCTTAG pLKO_005 2309 3UTR 100% 10.800 15.120 N RAD54L n/a
2 TRCN0000436188 AGATGCTGGTCCTGGATTATA pLKO_005 1546 CDS 100% 15.000 10.500 N RAD54L n/a
3 TRCN0000434180 AGTAGTGCTGGTGTCGAATTA pLKO_005 1601 CDS 100% 13.200 9.240 N RAD54L n/a
4 TRCN0000000229 CCAGAGTGCAAGCCAGAAATT pLKO.1 669 CDS 100% 13.200 9.240 N RAD54L n/a
5 TRCN0000427988 ACGCTGCAGTGCATCACATTG pLKO_005 624 CDS 100% 10.800 7.560 N RAD54L n/a
6 TRCN0000423255 GCCATCGATGGAGGATCTAAG pLKO_005 780 CDS 100% 10.800 7.560 N RAD54L n/a
7 TRCN0000413854 TGACTCCTAGGAAACGGAAAT pLKO_005 145 5UTR 100% 10.800 7.560 N RAD54L n/a
8 TRCN0000000230 CTTTGTAATCATCCAGCTCTA pLKO.1 1422 CDS 100% 4.050 2.835 N RAD54L n/a
9 TRCN0000000233 GTCCATTAAGAAGCGAGCCAA pLKO.1 1697 CDS 100% 2.640 1.848 N RAD54L n/a
10 TRCN0000000232 GTGAAGATTGAGCAGGTCGTT pLKO.1 1272 CDS 100% 2.640 1.848 N RAD54L n/a
11 TRCN0000000231 CCTGGATTATATTCTGGCGGT pLKO.1 1556 CDS 100% 0.540 0.378 N RAD54L n/a
12 TRCN0000012217 GCCCATGAATTCAAGAAGCAT pLKO.1 1104 CDS 100% 0.000 0.000 N Rad54l n/a
13 TRCN0000281997 GCCCATGAATTCAAGAAGCAT pLKO_005 1104 CDS 100% 0.000 0.000 N Rad54l n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001370766.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.