Transcript: Human NM_001371224.1

Homo sapiens FERM and PDZ domain containing 1 (FRMPD1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-07-02
Taxon:
Homo sapiens (human)
Gene:
FRMPD1 (22844)
Length:
5068
CDS:
197..4933

Additional Resources:

NCBI RefSeq record:
NM_001371224.1
NBCI Gene record:
FRMPD1 (22844)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001371224.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000426045 TGCTGCCCAGCTACGTTTAAA pLKO_005 1330 CDS 100% 15.000 21.000 N FRMPD1 n/a
2 TRCN0000425685 ACACGGAAAGCACATAGAATA pLKO_005 227 CDS 100% 13.200 18.480 N FRMPD1 n/a
3 TRCN0000434038 GGATTAGCCAGGTTATCAATA pLKO_005 1464 CDS 100% 13.200 10.560 N FRMPD1 n/a
4 TRCN0000414404 TAGACGACGTGTGCTACTATG pLKO_005 2784 CDS 100% 10.800 7.560 N FRMPD1 n/a
5 TRCN0000128160 GATAGCTTCTATCCCTACAAA pLKO.1 3478 CDS 100% 5.625 3.938 N FRMPD1 n/a
6 TRCN0000128181 CTCAAGCTATACTTGGAGAAT pLKO.1 743 CDS 100% 4.950 3.465 N FRMPD1 n/a
7 TRCN0000129061 GAAAGCCATTAGCTTCCACAT pLKO.1 1261 CDS 100% 4.050 2.835 N FRMPD1 n/a
8 TRCN0000149524 GCTCAAGCTATACTTGGAGAA pLKO.1 742 CDS 100% 4.050 2.835 N FRMPD1 n/a
9 TRCN0000129844 CAGGACTATGGATTTCACATT pLKO.1 395 CDS 100% 4.950 2.970 N FRMPD1 n/a
10 TRCN0000146494 CCCTGATTTCTTTCTTGGGAA pLKO.1 3817 CDS 100% 2.640 1.584 N FRMPD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001371224.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.