Transcript: Human NM_001371371.1

Homo sapiens MAP3K7 C-terminal like (MAP3K7CL), transcript variant 12, mRNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
MAP3K7CL (56911)
Length:
1741
CDS:
261..746

Additional Resources:

NCBI RefSeq record:
NM_001371371.1
NBCI Gene record:
MAP3K7CL (56911)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001371371.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000368595 GCAGGGCTCGTCCTAACTTTA pLKO_005 731 CDS 100% 13.200 18.480 N MAP3K7CL n/a
2 TRCN0000078646 GCCCAGTCTCAATGTGTGGAA pLKO.1 675 CDS 100% 2.640 3.696 N MAP3K7CL n/a
3 TRCN0000078643 CCACATGACAACTGTCTATAA pLKO.1 856 3UTR 100% 13.200 9.240 N MAP3K7CL n/a
4 TRCN0000078647 ACTGCCAAATAGCAGAAGAAT pLKO.1 502 CDS 100% 5.625 3.938 N MAP3K7CL n/a
5 TRCN0000078645 CCCTGAAGACTCCATTCCTTT pLKO.1 398 CDS 100% 4.950 3.465 N MAP3K7CL n/a
6 TRCN0000078961 GCACTGCCAAATAGCAGAAGA pLKO.1 500 CDS 100% 4.950 3.465 N Map3k7cl n/a
7 TRCN0000078644 CCAGAATTAGACCAGCAGCTA pLKO.1 426 CDS 100% 2.640 1.848 N MAP3K7CL n/a
8 TRCN0000359213 CAACTGGAGAAACTTCGAATA pLKO_005 696 CDS 100% 10.800 6.480 N MAP3K7CL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001371371.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.