Transcript: Human NM_001371415.1

Homo sapiens angiotensin I converting enzyme 2 (ACE2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-15
Taxon:
Homo sapiens (human)
Gene:
ACE2 (59272)
Length:
3339
CDS:
50..2467

Additional Resources:

NCBI RefSeq record:
NM_001371415.1
NBCI Gene record:
ACE2 (59272)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001371415.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000437879 GGGCGACTTCAGGATCCTTAT pLKO_005 1108 CDS 100% 10.800 15.120 N ACE2 n/a
2 TRCN0000046695 GCAAAGTTGATGAATGCCTAT pLKO.1 785 CDS 100% 4.050 3.240 N ACE2 n/a
3 TRCN0000429855 TTATGCCTCCATCGATATTAG pLKO_005 2389 CDS 100% 13.200 9.240 N ACE2 n/a
4 TRCN0000046697 GCCGAAGACCTGTTCTATCAA pLKO.1 155 CDS 100% 5.625 3.938 N ACE2 n/a
5 TRCN0000046696 GCTGGACAGAAACTGTTCAAT pLKO.1 1697 CDS 100% 5.625 3.938 N ACE2 n/a
6 TRCN0000031147 CCAAACATAGATGTTACTGAT pLKO.1 914 CDS 100% 4.950 3.465 N Ace2 n/a
7 TRCN0000046694 GCCCAAATGTATCCACTACAA pLKO.1 287 CDS 100% 4.950 3.465 N ACE2 n/a
8 TRCN0000046693 GCCCTTATTTACCTGGCTGAA pLKO.1 1816 CDS 100% 4.050 2.835 N ACE2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001371415.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.