Transcript: Human NM_001374299.1

Homo sapiens isoleucyl-tRNA synthetase 1 (IARS1), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-19
Taxon:
Homo sapiens (human)
Gene:
IARS1 (3376)
Length:
4408
CDS:
95..3808

Additional Resources:

NCBI RefSeq record:
NM_001374299.1
NBCI Gene record:
IARS1 (3376)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001374299.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000045853 GCGGGTACAATTAAAGATATA pLKO.1 275 CDS 100% 13.200 18.480 N IARS1 n/a
2 TRCN0000045855 CCCATAAAGTATCCTTTGAAA pLKO.1 2543 CDS 100% 5.625 7.875 N IARS1 n/a
3 TRCN0000421318 TACTTCAGCCCACAGTTTATT pLKO_005 4049 3UTR 100% 15.000 12.000 N IARS1 n/a
4 TRCN0000045854 CCGCCTTTCAAGAACGTAATT pLKO.1 1838 CDS 100% 13.200 10.560 N IARS1 n/a
5 TRCN0000415729 ATGTTGCCAGAGGACGATTAC pLKO_005 840 CDS 100% 10.800 7.560 N IARS1 n/a
6 TRCN0000045856 GCAGGAAATTACAGAAGACAT pLKO.1 3721 CDS 100% 4.950 3.465 N IARS1 n/a
7 TRCN0000045857 CGCAGAAGATTAAAGGGTGAA pLKO.1 2309 CDS 100% 4.050 2.835 N IARS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001374299.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.