Transcript: Human NM_001374354.1

Homo sapiens GLI family zinc finger 2 (GLI2), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-23
Taxon:
Homo sapiens (human)
Gene:
GLI2 (2736)
Length:
7030
CDS:
718..5052

Additional Resources:

NCBI RefSeq record:
NM_001374354.1
NBCI Gene record:
GLI2 (2736)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001374354.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000238362 TGAGTCGTCCAGCCAAATTTA pLKO_005 6751 3UTR 100% 15.000 10.500 N GLI2 n/a
2 TRCN0000238360 AGGCTGAGGTGGTCATCTATG pLKO_005 1577 CDS 100% 10.800 7.560 N GLI2 n/a
3 TRCN0000238364 CCTGGCATGACTACCACTATG pLKO_005 3994 CDS 100% 10.800 7.560 N GLI2 n/a
4 TRCN0000238361 CTGGACAGGGATGACTGTAAG pLKO_005 1552 CDS 100% 10.800 7.560 N GLI2 n/a
5 TRCN0000033333 CCAACGAGAAACCCTACATCT pLKO.1 1967 CDS 100% 4.950 3.465 N GLI2 n/a
6 TRCN0000033329 CCGCTTCAGATGACAGATGTT pLKO.1 5178 3UTR 100% 4.950 3.465 N GLI2 n/a
7 TRCN0000033330 CACTCAAGGATTCCTGCTCAT pLKO.1 2507 CDS 100% 4.050 2.835 N GLI2 n/a
8 TRCN0000033332 GCTCTACTACTACGGCCAGAT pLKO.1 4623 CDS 100% 4.050 2.835 N GLI2 n/a
9 TRCN0000033331 GTTCCTGAACATGATGACCTA pLKO.1 5031 CDS 100% 2.640 1.848 N GLI2 n/a
10 TRCN0000166364 CACACACACACACACACACAA pLKO.1 6386 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001374354.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.