Transcript: Human NM_001374423.1

Homo sapiens NIMA related kinase 1 (NEK1), transcript variant 11, mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
NEK1 (4750)
Length:
4002
CDS:
613..1884

Additional Resources:

NCBI RefSeq record:
NM_001374423.1
NBCI Gene record:
NEK1 (4750)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001374423.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000232042 ACAAAGCCTGCCGCTAAATAT pLKO_005 1537 CDS 100% 15.000 21.000 N NEK1 n/a
2 TRCN0000219755 GGATCTGTTTAAGCGAATAAA pLKO.1 870 CDS 100% 15.000 21.000 N NEK1 n/a
3 TRCN0000232041 GGATCTGTTTAAGCGAATAAA pLKO_005 870 CDS 100% 15.000 21.000 N NEK1 n/a
4 TRCN0000382291 CCATCAGTCAACTCCATATTG pLKO_005 1351 CDS 100% 13.200 18.480 N NEK1 n/a
5 TRCN0000021581 CCGCTAAATATGGAATACCTT pLKO.1 1547 CDS 100% 3.000 2.400 N NEK1 n/a
6 TRCN0000379609 AGTTTGGTGTCTCAGTTATTT pLKO_005 1309 CDS 100% 15.000 10.500 N NEK1 n/a
7 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3263 3UTR 100% 5.625 2.813 Y KLHL30 n/a
8 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3263 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001374423.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.