Transcript: Human NM_001379.4

Homo sapiens DNA methyltransferase 1 (DNMT1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-10
Taxon:
Homo sapiens (human)
Gene:
DNMT1 (1786)
Length:
5226
CDS:
55..4905

Additional Resources:

NCBI RefSeq record:
NM_001379.4
NBCI Gene record:
DNMT1 (1786)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001379.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000232748 CCCGAGTATGCGCCCATATTT pLKO_005 1531 CDS 100% 15.000 21.000 N DNMT1 n/a
2 TRCN0000232751 GAGGTTCGCTTATCAACTAAT pLKO_005 5046 3UTR 100% 13.200 18.480 N DNMT1 n/a
3 TRCN0000232750 ACCGAATTGGCCGGATCAAAG pLKO_005 3026 CDS 100% 10.800 15.120 N DNMT1 n/a
4 TRCN0000021892 CGAGAAGAATATCGAACTCTT pLKO.1 1335 CDS 100% 4.950 6.930 N DNMT1 n/a
5 TRCN0000021891 GCCCAATGAGACTGACATCAA pLKO.1 3078 CDS 100% 4.950 6.930 N DNMT1 n/a
6 TRCN0000021890 GCCGAATACATTCTGATGGAT pLKO.1 1504 CDS 100% 3.000 4.200 N DNMT1 n/a
7 TRCN0000364177 GACGACCCTGACCTCAAATAT pLKO_005 1135 CDS 100% 15.000 10.500 N DNMT1 n/a
8 TRCN0000232749 CGATGAGGAAGTCGATGATAA pLKO_005 2157 CDS 100% 13.200 9.240 N DNMT1 n/a
9 TRCN0000232747 TTGAATCTCTTGCACGAATTT pLKO_005 190 CDS 100% 13.200 9.240 N DNMT1 n/a
10 TRCN0000364187 ATCAAATTGTGCAGTACTTTG pLKO_005 5076 3UTR 100% 10.800 7.560 N DNMT1 n/a
11 TRCN0000364186 GATCAAGACTACGCGAGATTC pLKO_005 2662 CDS 100% 10.800 7.560 N DNMT1 n/a
12 TRCN0000021893 CGACTACATCAAAGGCAGCAA pLKO.1 2985 CDS 100% 2.640 1.848 N DNMT1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001379.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.