Transcript: Human NM_001405.4

Homo sapiens ephrin A2 (EFNA2), mRNA.

Source:
NCBI, updated 2019-09-15
Taxon:
Homo sapiens (human)
Gene:
EFNA2 (1943)
Length:
2424
CDS:
297..938

Additional Resources:

NCBI RefSeq record:
NM_001405.4
NBCI Gene record:
EFNA2 (1943)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001405.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000421387 ACCAGCAATAACTCGTGTAGC pLKO_005 852 CDS 100% 4.050 5.670 N EFNA2 n/a
2 TRCN0000058257 CTCGGACCGCTACGCCGTCTA pLKO.1 395 CDS 100% 0.000 0.000 N EFNA2 n/a
3 TRCN0000058254 GACATCTACTGCCCGCACTAT pLKO.1 504 CDS 100% 4.950 3.465 N EFNA2 n/a
4 TRCN0000058253 GCTCAAGTTCTCGGAGAAGTT pLKO.1 665 CDS 100% 4.950 3.465 N EFNA2 n/a
5 TRCN0000058256 CATGGAGCACTACGTGCTGTA pLKO.1 551 CDS 100% 4.050 2.835 N EFNA2 n/a
6 TRCN0000058255 CGGCCACGAGTATTACTACAT pLKO.1 728 CDS 100% 4.950 2.970 N EFNA2 n/a
7 TRCN0000418465 TACACGGTGGAGGTGAGCATC pLKO_005 471 CDS 100% 1.350 0.810 N EFNA2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001405.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.