Transcript: Human NM_001407.3

Homo sapiens cadherin EGF LAG seven-pass G-type receptor 3 (CELSR3), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
CELSR3 (1951)
Length:
11933
CDS:
253..10191

Additional Resources:

NCBI RefSeq record:
NM_001407.3
NBCI Gene record:
CELSR3 (1951)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001407.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000356772 AGCCGAAAGCTAGACAATAAC pLKO_005 3943 CDS 100% 13.200 18.480 N CELSR3 n/a
2 TRCN0000356770 ATTATCATTCTCCTCGTTTAC pLKO_005 7471 CDS 100% 10.800 15.120 N CELSR3 n/a
3 TRCN0000011247 CCTAATATCATGCTCAGCATT pLKO.1 7216 CDS 100% 4.950 6.930 N CELSR3 n/a
4 TRCN0000011246 CGCTACTTCAAGCTGGTACTA pLKO.1 2725 CDS 100% 4.950 6.930 N CELSR3 n/a
5 TRCN0000011244 CCTGCTTGAATTGATTCCGAA pLKO.1 11032 3UTR 100% 2.640 2.112 N CELSR3 n/a
6 TRCN0000356771 TGGCCACACTGACCACTATTT pLKO_005 6900 CDS 100% 13.200 9.240 N CELSR3 n/a
7 TRCN0000356825 CTACTTCAAGCTGGTACTAAC pLKO_005 2727 CDS 100% 10.800 7.560 N CELSR3 n/a
8 TRCN0000011248 CCATTATCATTCTCCTCGTTT pLKO.1 7469 CDS 100% 4.950 3.465 N CELSR3 n/a
9 TRCN0000011245 GCACTCATTGACCTAGACTAT pLKO.1 3628 CDS 100% 4.950 3.465 N CELSR3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001407.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.