Transcript: Human NM_001427.4

Homo sapiens engrailed homeobox 2 (EN2), mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
EN2 (2020)
Length:
3395
CDS:
250..1251

Additional Resources:

NCBI RefSeq record:
NM_001427.4
NBCI Gene record:
EN2 (2020)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001427.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000013904 GAACCCGAACAAAGAGGACAA pLKO.1 963 CDS 100% 4.050 5.670 N EN2 n/a
2 TRCN0000013907 CCGCATCACCAACTTCTTCAT pLKO.1 441 CDS 100% 4.950 3.465 N EN2 n/a
3 TRCN0000013905 CGAGTTCCAGACCAACAGGTA pLKO.1 1032 CDS 100% 2.640 1.848 N EN2 n/a
4 TRCN0000013906 ACCAAAGAAGAAGAACCCGAA pLKO.1 951 CDS 100% 2.160 1.512 N EN2 n/a
5 TRCN0000013903 CCGAATAAATAGCTCCTATTT pLKO.1 1659 3UTR 100% 1.320 0.924 N EN2 n/a
6 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2561 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001427.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.