Transcript: Human NM_001441.3

Homo sapiens fatty acid amide hydrolase (FAAH), mRNA.

Source:
NCBI, updated 2019-09-01
Taxon:
Homo sapiens (human)
Gene:
FAAH (2166)
Length:
2042
CDS:
33..1772

Additional Resources:

NCBI RefSeq record:
NM_001441.3
NBCI Gene record:
FAAH (2166)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001441.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000050636 GTACTATGAGACTGACAACTA pLKO.1 1016 CDS 100% 4.950 6.930 N FAAH n/a
2 TRCN0000050635 CGTCAGCTACACTATGCTGTA pLKO.1 1502 CDS 100% 4.050 5.670 N FAAH n/a
3 TRCN0000446867 GAGATCGAGGTGTACCGCAAA pLKO_005 1380 CDS 100% 4.050 5.670 N FAAH n/a
4 TRCN0000050634 GCTCTTCACCTATGTGGGAAA pLKO.1 320 CDS 100% 4.050 3.240 N FAAH n/a
5 TRCN0000050633 CCACAGTCCATGTTCAGCTAT pLKO.1 594 CDS 100% 4.950 3.465 N FAAH n/a
6 TRCN0000416787 GGACCTGGTCTCAATTCTGAA pLKO_005 1238 CDS 100% 4.950 3.465 N FAAH n/a
7 TRCN0000443152 AGGAGTGCTTCACCTACAAGG pLKO_005 457 CDS 100% 4.050 2.835 N FAAH n/a
8 TRCN0000431006 TGAACAAAGGGACCAACTGTG pLKO_005 352 CDS 100% 4.050 2.835 N FAAH n/a
9 TRCN0000050637 AGAAGAGTTGTGTCTGCGGTT pLKO.1 1703 CDS 100% 2.160 1.296 N FAAH n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001441.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.