Transcript: Human NM_001456.3

Homo sapiens filamin A (FLNA), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-27
Taxon:
Homo sapiens (human)
Gene:
FLNA (2316)
Length:
8533
CDS:
250..8169

Additional Resources:

NCBI RefSeq record:
NM_001456.3
NBCI Gene record:
FLNA (2316)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001456.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000062531 CATGCGTATGTCCCACCTAAA pLKO.1 6096 CDS 100% 10.800 15.120 N FLNA n/a
2 TRCN0000062532 GACCGCCAATAACGACAAGAA pLKO.1 1245 CDS 100% 4.950 6.930 N FLNA n/a
3 TRCN0000062529 CCCACCCACTTCACAGTAAAT pLKO.1 2923 CDS 100% 13.200 9.240 N FLNA n/a
4 TRCN0000441495 GGCCAACGTTGGTAGTCATTG pLKO_005 6684 CDS 100% 10.800 7.560 N FLNA n/a
5 TRCN0000062530 CGGCACTTTCGACATCTTCTA pLKO.1 5340 CDS 100% 4.950 3.465 N FLNA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001456.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.