Transcript: Human NM_001492.6

Homo sapiens growth differentiation factor 1 (GDF1), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
GDF1 (2657)
Length:
2579
CDS:
1409..2527

Additional Resources:

NCBI RefSeq record:
NM_001492.6
NBCI Gene record:
GDF1 (2657)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001492.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000167819 GTTCACCAAGCTCAACATTTA pLKO.1 737 5UTR 100% 13.200 6.600 Y CERS1 n/a
2 TRCN0000168362 GAGTTCACCAAGCTCAACATT pLKO.1 735 5UTR 100% 5.625 2.813 Y CERS1 n/a
3 TRCN0000139300 CCCTTATGAACCTCTACTGGT pLKO.1 961 5UTR 100% 2.640 1.320 Y CERS1 n/a
4 TRCN0000168046 CCTTATGAACCTCTACTGGTT pLKO.1 962 5UTR 100% 2.640 1.320 Y CERS1 n/a
5 TRCN0000058338 CCCTGAGTGGACAGTCGTCTT pLKO.1 1780 CDS 100% 1.350 0.675 Y GDF1 n/a
6 TRCN0000058339 CGGAAACATCGTGCGCCACAT pLKO.1 1702 CDS 100% 1.350 0.675 Y GDF1 n/a
7 TRCN0000122550 CGGAAACATCGTGCGCCACAT pLKO.1 1702 CDS 100% 1.350 0.675 Y CERS1 n/a
8 TRCN0000168211 CTACTTCTTCTTCAATGCGCT pLKO.1 926 5UTR 100% 0.660 0.330 Y CERS1 n/a
9 TRCN0000140139 GCTTGAGTTCACCAAGCTCAA pLKO.1 731 5UTR 100% 0.405 0.203 Y CERS1 n/a
10 TRCN0000058341 CCAGGCTCTAGGACTGCGCGA pLKO.1 1528 CDS 100% 0.000 0.000 Y GDF1 n/a
11 TRCN0000058340 CTGGCCAACTACTGCCAGGGT pLKO.1 2282 CDS 100% 0.000 0.000 Y GDF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001492.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.