Transcript: Human NM_001517.5

Homo sapiens general transcription factor IIH subunit 4 (GTF2H4), mRNA.

Source:
NCBI, updated 2019-08-27
Taxon:
Homo sapiens (human)
Gene:
GTF2H4 (2968)
Length:
1712
CDS:
201..1589

Additional Resources:

NCBI RefSeq record:
NM_001517.5
NBCI Gene record:
GTF2H4 (2968)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001517.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000016374 GAAACCAATTACCGACTGTAT pLKO.1 1128 CDS 100% 4.950 6.930 N LOC399704 n/a
2 TRCN0000016373 CCAGGTTTCATTGTCGTGGAA pLKO.1 1110 CDS 100% 2.640 2.112 N LOC399704 n/a
3 TRCN0000220070 CGGCTCAGCTCTGGTACTTTA pLKO.1 826 CDS 100% 13.200 9.240 N GTF2H4 n/a
4 TRCN0000220069 GAACCGAGTACACCTACAATG pLKO.1 227 CDS 100% 10.800 7.560 N GTF2H4 n/a
5 TRCN0000147711 GAGTGATTCTCTGTTGAACTT pLKO.1 962 CDS 100% 4.950 3.465 N GTF2H4 n/a
6 TRCN0000016375 GTACACCTACAATGCAGGAAT pLKO.1 234 CDS 100% 4.950 3.465 N LOC399704 n/a
7 TRCN0000146580 CAGCAGATAATCCATTTCCTA pLKO.1 1284 CDS 100% 3.000 2.100 N GTF2H4 n/a
8 TRCN0000016377 CCAGCAGATAATCCATTTCCT pLKO.1 1283 CDS 100% 3.000 2.100 N LOC399704 n/a
9 TRCN0000180976 CTCTGAGATGCTCTATCGGTT pLKO.1 1193 CDS 100% 2.640 1.848 N GTF2H4 n/a
10 TRCN0000016376 CTGTTGAACTTCCTGCAACAT pLKO.1 972 CDS 100% 0.495 0.347 N LOC399704 n/a
11 TRCN0000086045 CCAGTGATGCTCAAACAGAAT pLKO.1 1320 CDS 100% 4.950 2.970 N Gtf2h4 n/a
12 TRCN0000316032 CCAGTGATGCTCAAACAGAAT pLKO_005 1320 CDS 100% 4.950 2.970 N Gtf2h4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001517.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.