Transcript: Human NM_001605.2

Homo sapiens alanyl-tRNA synthetase 1 (AARS1), mRNA.

Source:
NCBI, updated 2019-07-17
Taxon:
Homo sapiens (human)
Gene:
AARS1 (16)
Length:
3344
CDS:
111..3017

Additional Resources:

NCBI RefSeq record:
NM_001605.2
NBCI Gene record:
AARS1 (16)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001605.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000045690 GCAGCGATTTATAGATTTCTT pLKO.1 143 CDS 100% 5.625 7.875 N AARS1 n/a
2 TRCN0000293748 GTCAACCAGGACGACCCTAAT pLKO_005 720 CDS 100% 10.800 8.640 N AARS1 n/a
3 TRCN0000045692 CGATGTCCAGAAACGAGTGTT pLKO.1 2615 CDS 100% 4.950 3.960 N AARS1 n/a
4 TRCN0000286306 CGATGTCCAGAAACGAGTGTT pLKO_005 2615 CDS 100% 4.950 3.960 N AARS1 n/a
5 TRCN0000045689 GCAGAATAAGATGTCCAACTA pLKO.1 863 CDS 100% 4.950 3.960 N AARS1 n/a
6 TRCN0000286307 GCAGAATAAGATGTCCAACTA pLKO_005 863 CDS 100% 4.950 3.960 N AARS1 n/a
7 TRCN0000293747 TCATCTGCTACAAGAACATTT pLKO_005 3069 3UTR 100% 13.200 9.240 N AARS1 n/a
8 TRCN0000045691 GACCTCATTATGCTGGACATT pLKO.1 1491 CDS 100% 4.950 3.465 N AARS1 n/a
9 TRCN0000293689 ACATGGTGAAGGACATCATTA pLKO_005 1216 CDS 100% 13.200 7.920 N AARS1 n/a
10 TRCN0000045688 CCCAGGCAACATGAAGGATAA pLKO.1 611 CDS 100% 10.800 6.480 N AARS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001605.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.