Transcript: Human NM_001624.4

Homo sapiens crystallin beta-gamma domain containing 1 (CRYBG1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-27
Taxon:
Homo sapiens (human)
Gene:
CRYBG1 (202)
Length:
9110
CDS:
488..5659

Additional Resources:

NCBI RefSeq record:
NM_001624.4
NBCI Gene record:
CRYBG1 (202)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001624.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000162467 CGTCACAAATGGTGGCATTAA pLKO.1 2941 CDS 100% 13.200 18.480 N CRYBG1 n/a
2 TRCN0000158490 CGAAATCAGATTCACTTGTTT pLKO.1 4727 CDS 100% 5.625 7.875 N CRYBG1 n/a
3 TRCN0000159666 GCCTTAGGTATTCACACATTT pLKO.1 6204 3UTR 100% 13.200 10.560 N CRYBG1 n/a
4 TRCN0000162264 CCACTGTGGATACCAAAGATT pLKO.1 1782 CDS 100% 5.625 3.938 N CRYBG1 n/a
5 TRCN0000161351 GCCAGATCAGACTGTTACAAA pLKO.1 2479 CDS 100% 5.625 3.938 N CRYBG1 n/a
6 TRCN0000158606 CCTAATTTCTTGTCCTCCTAT pLKO.1 6799 3UTR 100% 4.950 3.465 N CRYBG1 n/a
7 TRCN0000159737 GAATGTCATTATCAGACACAA pLKO.1 3486 CDS 100% 4.950 3.465 N CRYBG1 n/a
8 TRCN0000161204 GTTCAGGTTATTGGTGGCATA pLKO.1 5099 CDS 100% 4.050 2.835 N CRYBG1 n/a
9 TRCN0000160150 CTTCTGTTCAACCTATATGTT pLKO.1 4680 CDS 100% 5.625 3.375 N CRYBG1 n/a
10 TRCN0000165506 GCTCTGATTCCTGTCAAGGAT pLKO.1 1670 CDS 100% 3.000 1.800 N CRYBG1 n/a
11 TRCN0000139012 CGCCTGTAATCCCAGAACTTT pLKO.1 8530 3UTR 100% 5.625 2.813 Y CCDC57 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001624.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.