Transcript: Human NM_001718.6

Homo sapiens bone morphogenetic protein 6 (BMP6), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
BMP6 (654)
Length:
3784
CDS:
858..2399

Additional Resources:

NCBI RefSeq record:
NM_001718.6
NBCI Gene record:
BMP6 (654)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001718.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000424808 ATACAGGAATATGGTTGTAAG pLKO_005 2360 CDS 100% 10.800 15.120 N BMP6 n/a
2 TRCN0000436913 CGCCGACAACAGAGTCGTAAT pLKO_005 1995 CDS 100% 10.800 15.120 N BMP6 n/a
3 TRCN0000424724 GCAGACCTTGGTTCACCTTAT pLKO_005 2240 CDS 100% 10.800 8.640 N BMP6 n/a
4 TRCN0000065652 CCACAAAGAGTTCAAGTTCAA pLKO.1 1559 CDS 100% 4.950 3.960 N Bmp6 n/a
5 TRCN0000058617 CGCACACATGAATGCAACCAA pLKO.1 2207 CDS 100% 3.000 2.400 N BMP6 n/a
6 TRCN0000427881 CTGTCTATCAAAGGTAGATTT pLKO_005 2812 3UTR 100% 13.200 9.240 N BMP6 n/a
7 TRCN0000439198 GTTGGACACCCGTGTAGTATG pLKO_005 1733 CDS 100% 10.800 7.560 N BMP6 n/a
8 TRCN0000058613 CGCATCTACAAGGACTGTGTT pLKO.1 1626 CDS 100% 4.950 3.465 N BMP6 n/a
9 TRCN0000058614 GCATGAGCTGTATGTGAGTTT pLKO.1 2099 CDS 100% 4.950 3.465 N BMP6 n/a
10 TRCN0000058615 GCGACACCACAAAGAGTTCAA pLKO.1 1553 CDS 100% 4.950 3.465 N BMP6 n/a
11 TRCN0000058616 GCCAACTAAGCTAAATGCCAT pLKO.1 2294 CDS 100% 2.640 1.848 N BMP6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001718.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.