Transcript: Human NM_001773.3

Homo sapiens CD34 molecule (CD34), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CD34 (947)
Length:
2598
CDS:
46..1032

Additional Resources:

NCBI RefSeq record:
NM_001773.3
NBCI Gene record:
CD34 (947)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001773.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000057521 CGACAGTCAAATTCACATCTA pLKO.1 311 CDS 100% 4.950 3.960 N CD34 n/a
2 TRCN0000057519 CTATACATCATCTTCTCCTAT pLKO.1 525 CDS 100% 4.950 3.960 N CD34 n/a
3 TRCN0000057520 ACTGGCTATTTCCTGATGAAT pLKO.1 964 CDS 100% 5.625 3.938 N CD34 n/a
4 TRCN0000057522 CCTGGAAATGTTTCAGACCTT pLKO.1 463 CDS 100% 2.640 1.848 N CD34 n/a
5 TRCN0000057518 CCTCTGTGATAACCTCAGTTT pLKO.1 332 CDS 100% 4.950 2.970 N CD34 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001773.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.