Transcript: Human NM_001794.5

Homo sapiens cadherin 4 (CDH4), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
CDH4 (1002)
Length:
6678
CDS:
254..3004

Additional Resources:

NCBI RefSeq record:
NM_001794.5
NBCI Gene record:
CDH4 (1002)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001794.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000417768 TCCGGTCCGACAAAGACAATG pLKO_005 831 CDS 100% 10.800 15.120 N CDH4 n/a
2 TRCN0000054059 CGACCTGTACATCTACGTCAT pLKO.1 1036 CDS 100% 4.050 5.670 N CDH4 n/a
3 TRCN0000413964 ACACGAAGCAGCTGCTCATTG pLKO_005 2544 CDS 100% 10.800 7.560 N CDH4 n/a
4 TRCN0000429665 CCAAACTGGAATGCCGTTTAC pLKO_005 1523 CDS 100% 10.800 7.560 N CDH4 n/a
5 TRCN0000054060 CACGTCCATCATCAAAGTCAA pLKO.1 2359 CDS 100% 4.950 3.465 N CDH4 n/a
6 TRCN0000054062 CCAGATCTATCTCATTGACAT pLKO.1 2056 CDS 100% 4.950 3.465 N CDH4 n/a
7 TRCN0000054058 CCGAGAGAAAGTTCAGCAGTA pLKO.1 1297 CDS 100% 4.050 2.835 N CDH4 n/a
8 TRCN0000054061 TGAAGATGATTACACGGCATT pLKO.1 361 CDS 100% 4.050 2.835 N CDH4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001794.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.