Transcript: Human NM_001797.4

Homo sapiens cadherin 11 (CDH11), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
CDH11 (1009)
Length:
6722
CDS:
482..2872

Additional Resources:

NCBI RefSeq record:
NM_001797.4
NBCI Gene record:
CDH11 (1009)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001797.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000094829 GCCAGCTTAAACCCATACAAT pLKO.1 3337 3UTR 100% 5.625 7.875 N Cdh11 n/a
2 TRCN0000054335 GCGCCAAGTTAGTGTACAGTA pLKO.1 1062 CDS 100% 4.950 6.930 N CDH11 n/a
3 TRCN0000054337 CGACCCGAAGTTTATCAGCAA pLKO.1 1543 CDS 100% 2.640 3.696 N CDH11 n/a
4 TRCN0000303382 CACACTGACCTCGACAGATTT pLKO_005 1751 CDS 100% 13.200 10.560 N CDH11 n/a
5 TRCN0000303385 CAATGTGGGAACGTCAGTAAT pLKO_005 997 CDS 100% 13.200 9.240 N CDH11 n/a
6 TRCN0000303384 GACTTCATCAACACGAGAATA pLKO_005 2636 CDS 100% 13.200 9.240 N CDH11 n/a
7 TRCN0000329523 GAGCTGTAATTTCGCCTTAAA pLKO_005 3263 3UTR 100% 13.200 9.240 N Cdh11 n/a
8 TRCN0000303363 TAAACTCTGGACACTCTATAT pLKO_005 3280 3UTR 100% 13.200 9.240 N CDH11 n/a
9 TRCN0000054336 CCACTTTCCAACCAGCCAATT pLKO.1 1991 CDS 100% 10.800 7.560 N CDH11 n/a
10 TRCN0000307940 CCACTTTCCAACCAGCCAATT pLKO_005 1991 CDS 100% 10.800 7.560 N CDH11 n/a
11 TRCN0000054334 CCGTGAGAACATCATTACTTA pLKO.1 2449 CDS 100% 5.625 3.938 N CDH11 n/a
12 TRCN0000054333 GCAGATTTGTATGGTTCCAAA pLKO.1 2828 CDS 100% 4.950 3.465 N CDH11 n/a
13 TRCN0000094833 CCAAGATTTATCTTCAGCCTA pLKO.1 2054 CDS 100% 2.640 1.848 N Cdh11 n/a
14 TRCN0000329454 TCAAACCTGAGTATCAGTATA pLKO_005 2568 CDS 100% 13.200 9.240 N Cdh11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001797.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.