Transcript: Human NM_001814.6

Homo sapiens cathepsin C (CTSC), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
CTSC (1075)
Length:
1870
CDS:
65..1456

Additional Resources:

NCBI RefSeq record:
NM_001814.6
NBCI Gene record:
CTSC (1075)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001814.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000003608 GCAGGAAAGTACGCCCAAGAT pLKO.1 983 CDS 100% 4.950 6.930 N CTSC n/a
2 TRCN0000279748 GCAGGAAAGTACGCCCAAGAT pLKO_005 983 CDS 100% 4.950 6.930 N CTSC n/a
3 TRCN0000003610 GTATAAAGAAGAGGGCAGCAA pLKO.1 382 CDS 100% 2.640 2.112 N CTSC n/a
4 TRCN0000003611 GATGACTTCCTCCACTACAAA pLKO.1 1196 CDS 100% 5.625 3.938 N CTSC n/a
5 TRCN0000279813 GATGACTTCCTCCACTACAAA pLKO_005 1196 CDS 100% 5.625 3.938 N CTSC n/a
6 TRCN0000003607 GCTGCTACTCATTTGCTTCTA pLKO.1 834 CDS 100% 4.950 3.465 N CTSC n/a
7 TRCN0000279750 GCTGCTACTCATTTGCTTCTA pLKO_005 834 CDS 100% 4.950 3.465 N CTSC n/a
8 TRCN0000003609 TATACCTTTCAATCGGCCACT pLKO.1 1613 3UTR 100% 2.160 1.512 N CTSC n/a
9 TRCN0000279815 TATACCTTTCAATCGGCCACT pLKO_005 1613 3UTR 100% 2.160 1.512 N CTSC n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001814.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.