Transcript: Human NM_001829.4

Homo sapiens chloride voltage-gated channel 3 (CLCN3), transcript variant b, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
CLCN3 (1182)
Length:
6635
CDS:
503..2959

Additional Resources:

NCBI RefSeq record:
NM_001829.4
NBCI Gene record:
CLCN3 (1182)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001829.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000310262 CGACGCAAGTCCACGAAATTT pLKO_005 1751 CDS 100% 15.000 21.000 N CLCN3 n/a
2 TRCN0000296174 TTATGCCTGGCACTCATATTT pLKO_005 2009 CDS 100% 15.000 21.000 N CLCN3 n/a
3 TRCN0000044936 CCGATTAAATGGATACCCTTT pLKO.1 2404 CDS 100% 4.050 5.670 N CLCN3 n/a
4 TRCN0000289143 CCGATTAAATGGATACCCTTT pLKO_005 2404 CDS 100% 4.050 5.670 N CLCN3 n/a
5 TRCN0000044935 CCTACCTCTTTCCAAAGTATA pLKO.1 1392 CDS 100% 13.200 9.240 N CLCN3 n/a
6 TRCN0000289144 CCTACCTCTTTCCAAAGTATA pLKO_005 1392 CDS 100% 13.200 9.240 N CLCN3 n/a
7 TRCN0000044933 GCTGTAACAAAGCCTCTTTAA pLKO.1 3527 3UTR 100% 13.200 9.240 N CLCN3 n/a
8 TRCN0000289200 GCTGTAACAAAGCCTCTTTAA pLKO_005 3527 3UTR 100% 13.200 9.240 N CLCN3 n/a
9 TRCN0000044934 GCTGCTTTAGTGGCTGCATTT pLKO.1 1565 CDS 100% 10.800 7.560 N CLCN3 n/a
10 TRCN0000044937 GCAGAATTAATCATAGGTCAA pLKO.1 1082 CDS 100% 4.050 2.835 N CLCN3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001829.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.