Transcript: Human NM_001854.4

Homo sapiens collagen type XI alpha 1 chain (COL11A1), transcript variant A, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
COL11A1 (1301)
Length:
7311
CDS:
345..5765

Additional Resources:

NCBI RefSeq record:
NM_001854.4
NBCI Gene record:
COL11A1 (1301)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001854.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000083377 CCACGAAACCACTTGATAGAA pLKO.1 901 CDS 100% 5.625 7.875 N COL11A1 n/a
2 TRCN0000433589 AGTATGCACCAGAGGATATAA pLKO_005 1123 CDS 100% 15.000 12.000 N COL11A1 n/a
3 TRCN0000083373 CCCAATTCTCAACTCTCCTTT pLKO.1 6001 3UTR 100% 4.950 3.960 N COL11A1 n/a
4 TRCN0000083374 CCTGGTACTATGTTGATGTTA pLKO.1 1809 CDS 100% 5.625 3.938 N COL11A1 n/a
5 TRCN0000083376 CCTGGTTTAATTGGCCTGATT pLKO.1 4707 CDS 100% 4.950 3.465 N COL11A1 n/a
6 TRCN0000083375 CCTCAAGGTATCTCAGGGAAA pLKO.1 3381 CDS 100% 4.050 2.835 N COL11A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001854.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.