Transcript: Human NM_001897.5

Homo sapiens chondroitin sulfate proteoglycan 4 (CSPG4), mRNA.

Source:
NCBI, updated 2019-06-08
Taxon:
Homo sapiens (human)
Gene:
CSPG4 (1464)
Length:
8290
CDS:
94..7062

Additional Resources:

NCBI RefSeq record:
NM_001897.5
NBCI Gene record:
CSPG4 (1464)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001897.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422851 AGGTCTACGCTGGGAATATTC pLKO_005 5042 CDS 100% 13.200 18.480 N CSPG4 n/a
2 TRCN0000137500 CAATGCATCAGCCGTAGTGAA pLKO.1 6192 CDS 100% 4.950 6.930 N CSPG4 n/a
3 TRCN0000136598 CATCACGGTGAGGGATGTAAA pLKO.1 5559 CDS 100% 13.200 9.240 N CSPG4 n/a
4 TRCN0000422139 GACGATGCCTATGGACATTAT pLKO_005 1258 CDS 100% 13.200 9.240 N CSPG4 n/a
5 TRCN0000437747 GCCACCTGCAGACATCGTATT pLKO_005 3900 CDS 100% 10.800 7.560 N CSPG4 n/a
6 TRCN0000136528 CTTTGCCACTGAGCCTTACAA pLKO.1 6570 CDS 100% 5.625 3.938 N CSPG4 n/a
7 TRCN0000135327 CAACATGTTCAGCGTCATCAT pLKO.1 6753 CDS 100% 4.950 3.465 N CSPG4 n/a
8 TRCN0000134736 GACTTCATCTATGTGGACATA pLKO.1 838 CDS 100% 4.950 3.465 N CSPG4 n/a
9 TRCN0000137407 GAGTATGAGGACGATGCCTAT pLKO.1 1249 CDS 100% 4.050 2.835 N CSPG4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001897.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.