Transcript: Human NM_001921.2

Homo sapiens dCMP deaminase (DCTD), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-12
Taxon:
Homo sapiens (human)
Gene:
DCTD (1635)
Length:
2019
CDS:
175..711

Additional Resources:

NCBI RefSeq record:
NM_001921.2
NBCI Gene record:
DCTD (1635)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001921.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000051873 CCGATGTGAAAGGCTGTAGTA pLKO.1 461 CDS 100% 4.950 6.930 N DCTD n/a
2 TRCN0000344084 TTGTCGGGATTGGGTACAATG pLKO_005 317 CDS 100% 10.800 8.640 N DCTD n/a
3 TRCN0000344083 GCTGCGAGGCTCCTGTTTAAT pLKO_005 592 CDS 100% 15.000 10.500 N DCTD n/a
4 TRCN0000344086 CAAGTGAAGCATGGCATATAG pLKO_005 1150 3UTR 100% 13.200 9.240 N DCTD n/a
5 TRCN0000344023 GAATAAGCTGGACACCAAATA pLKO_005 390 CDS 100% 13.200 9.240 N DCTD n/a
6 TRCN0000344022 TCATCATCCAGGCAGGTATAA pLKO_005 521 CDS 100% 13.200 9.240 N DCTD n/a
7 TRCN0000051876 AGCAAGATTGTCATTGACTTT pLKO.1 652 CDS 100% 4.950 3.465 N DCTD n/a
8 TRCN0000051875 CCTTCTTATCAGCACAGAGAA pLKO.1 242 CDS 100% 4.950 3.465 N DCTD n/a
9 TRCN0000051874 CCCTTGTAATGAATGCGCTAA pLKO.1 498 CDS 100% 4.050 2.835 N DCTD n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001921.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.