Transcript: Human NM_001937.5

Homo sapiens dermatopontin (DPT), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
DPT (1805)
Length:
1719
CDS:
33..638

Additional Resources:

NCBI RefSeq record:
NM_001937.5
NBCI Gene record:
DPT (1805)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001937.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000154275 GAAGTTCATAATGTGCCGGAT pLKO.1 584 CDS 100% 2.160 3.024 N DPT n/a
2 TRCN0000377834 ACAGCAAGAGGTGCCCATATT pLKO_005 436 CDS 100% 13.200 10.560 N DPT n/a
3 TRCN0000153974 CGATTATGGATACCCATACCA pLKO.1 95 CDS 100% 0.300 0.240 N DPT n/a
4 TRCN0000372049 GACATGATTTCCTACAATTAT pLKO_005 504 CDS 100% 15.000 10.500 N DPT n/a
5 TRCN0000155090 GATCGCCAGTGGAAGTTCATA pLKO.1 573 CDS 100% 5.625 3.938 N DPT n/a
6 TRCN0000150731 GCTAAGCCTGTTTGAATGATA pLKO.1 1052 3UTR 100% 5.625 3.938 N DPT n/a
7 TRCN0000153273 GTGAAGGTTCTCTACAGCTAA pLKO.1 1036 3UTR 100% 4.950 3.465 N DPT n/a
8 TRCN0000153437 CAGTATCATGACTACAGCGAT pLKO.1 117 CDS 100% 2.640 1.848 N DPT n/a
9 TRCN0000372106 CTAGTATCACACTTCTAATAA pLKO_005 798 3UTR 100% 0.000 0.000 N DPT n/a
10 TRCN0000154998 GCAAGAAGGAAGGTTCTGACA pLKO.1 223 CDS 100% 2.640 1.584 N DPT n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001937.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.