Transcript: Human NM_001942.4

Homo sapiens desmoglein 1 (DSG1), mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
DSG1 (1828)
Length:
7191
CDS:
142..3291

Additional Resources:

NCBI RefSeq record:
NM_001942.4
NBCI Gene record:
DSG1 (1828)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001942.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000416446 GAACTAACAGAGGGAGTTAAA pLKO_005 2104 CDS 100% 13.200 18.480 N DSG1 n/a
2 TRCN0000430653 TGGATACCCTGGGACCTAAAT pLKO_005 2384 CDS 100% 13.200 18.480 N DSG1 n/a
3 TRCN0000053810 CGAAGTCGAATCACAAAGTAT pLKO.1 3247 CDS 100% 5.625 7.875 N DSG1 n/a
4 TRCN0000053808 GCACCATCAAATGGCATTCAA pLKO.1 251 CDS 100% 5.625 7.875 N DSG1 n/a
5 TRCN0000053809 GCGGAATGTGAGTGCAACATT pLKO.1 892 CDS 100% 0.563 0.788 N DSG1 n/a
6 TRCN0000439931 CCCAATCTCTGGCGCTGATTT pLKO_005 2751 CDS 100% 13.200 10.560 N DSG1 n/a
7 TRCN0000053811 CCAGCAAGTTACATACCGCAT pLKO.1 381 CDS 100% 2.160 1.728 N DSG1 n/a
8 TRCN0000415983 ACTGGTAATATGGGATCAAAT pLKO_005 1324 CDS 100% 13.200 9.240 N DSG1 n/a
9 TRCN0000053812 GCCAGTATGCTCTTGCTGTAA pLKO.1 833 CDS 100% 4.950 3.465 N DSG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001942.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.