Transcript: Human NM_001988.4

Homo sapiens envoplakin (EVPL), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
EVPL (2125)
Length:
6468
CDS:
109..6210

Additional Resources:

NCBI RefSeq record:
NM_001988.4
NBCI Gene record:
EVPL (2125)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001988.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422089 GAACCTTGCAAAGGCCTATAC pLKO_005 2682 CDS 100% 10.800 15.120 N EVPL n/a
2 TRCN0000435346 TCACTCTCCATCGGCTCTATC pLKO_005 5473 CDS 100% 10.800 8.640 N EVPL n/a
3 TRCN0000113798 GCGGTATAAGCTGGTAGATAA pLKO.1 1413 CDS 100% 13.200 9.240 N EVPL n/a
4 TRCN0000113800 AGCGGTATAAGCTGGTAGATA pLKO.1 1412 CDS 100% 5.625 3.938 N EVPL n/a
5 TRCN0000113796 CCCTCTGTCCAACCACTGTTT pLKO.1 6309 3UTR 100% 4.950 3.465 N EVPL n/a
6 TRCN0000113799 CGTGGTGAAAGAGGTAGTCAA pLKO.1 3330 CDS 100% 4.950 3.465 N EVPL n/a
7 TRCN0000113797 GCAGGAGAAGACCATCTACAA pLKO.1 4650 CDS 100% 4.950 3.465 N EVPL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001988.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.