Transcript: Human NM_002016.2

Homo sapiens filaggrin (FLG), mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
FLG (2312)
Length:
12793
CDS:
73..12258

Additional Resources:

NCBI RefSeq record:
NM_002016.2
NBCI Gene record:
FLG (2312)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002016.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000083682 CCCAGATATGGTTGATGTCTT pLKO.1 222 CDS 100% 4.950 6.930 N FLG n/a
2 TRCN0000430344 GGTATTATGCAACGTATATTA pLKO_005 12149 CDS 100% 15.000 10.500 N FLG n/a
3 TRCN0000413743 TAGTTTGGTGGTAGCTTATTT pLKO_005 12394 3UTR 100% 15.000 10.500 N FLG n/a
4 TRCN0000428827 ACAATGAAGAAGGAGTATATG pLKO_005 698 CDS 100% 13.200 9.240 N FLG n/a
5 TRCN0000083678 CAGGCCATATTGCCACATATT pLKO.1 761 CDS 100% 13.200 9.240 N FLG n/a
6 TRCN0000430958 TATCATGGAGAGCTAACTTTA pLKO_005 12473 3UTR 100% 13.200 9.240 N FLG n/a
7 TRCN0000083679 CCAGGTCCCATCAAGAAGATA pLKO.1 4970 CDS 100% 5.625 3.938 N FLG n/a
8 TRCN0000083681 GCACTCGTCACACACAGAATT pLKO.1 2114 CDS 100% 0.000 0.000 N FLG n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002016.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.