Transcript: Human NM_002111.8

Homo sapiens huntingtin (HTT), mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
HTT (3064)
Length:
13498
CDS:
146..9580

Additional Resources:

NCBI RefSeq record:
NM_002111.8
NBCI Gene record:
HTT (3064)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002111.8, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000019869 CCGTGCAGATAAGAATGCTAT pLKO.1 4384 CDS 100% 4.950 3.960 N HTT n/a
2 TRCN0000323038 CCGTGCAGATAAGAATGCTAT pLKO_005 4384 CDS 100% 4.950 3.960 N HTT n/a
3 TRCN0000350710 TGGTTCAGTTACGGGTTAATT pLKO_005 4515 CDS 100% 15.000 10.500 N HTT n/a
4 TRCN0000322962 TGTTGCCGCAGCATCACTAAT pLKO_005 2926 CDS 100% 13.200 9.240 N HTT n/a
5 TRCN0000019873 GCTGCTGACTTGTTTACGAAA pLKO.1 9535 CDS 100% 4.950 3.465 N HTT n/a
6 TRCN0000322961 GCTGCTGACTTGTTTACGAAA pLKO_005 9535 CDS 100% 4.950 3.465 N HTT n/a
7 TRCN0000019871 CCCATCATTTATATCAGGCAT pLKO.1 7860 CDS 100% 2.640 1.848 N HTT n/a
8 TRCN0000019870 GCACTCAAGAAGGACACAATA pLKO.1 988 CDS 100% 13.200 7.920 N HTT n/a
9 TRCN0000323037 GCACTCAAGAAGGACACAATA pLKO_005 988 CDS 100% 13.200 7.920 N HTT n/a
10 TRCN0000019872 GCCCTTCAACAGGCACATTTA pLKO.1 2018 CDS 100% 13.200 7.920 N HTT n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002111.8, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.