Transcript: Human NM_002141.5

Homo sapiens homeobox A4 (HOXA4), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
HOXA4 (3201)
Length:
1687
CDS:
25..987

Additional Resources:

NCBI RefSeq record:
NM_002141.5
NBCI Gene record:
HOXA4 (3201)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002141.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000017506 GATCCATGTCAGCGCCGTTAA pLKO.1 624 CDS 100% 10.800 15.120 N HOXA4 n/a
2 TRCN0000422596 AGGACTACTTGGTATCAAATA pLKO_005 1254 3UTR 100% 13.200 9.240 N HOXA4 n/a
3 TRCN0000425816 GAGTTCCACTTCAATCGATAC pLKO_005 721 CDS 100% 6.000 4.200 N HOXA4 n/a
4 TRCN0000017505 CAACTACATCGAGCCCAAGTT pLKO.1 54 CDS 100% 4.950 3.465 N HOXA4 n/a
5 TRCN0000017504 GAAAGACCACAAACTGCCCAA pLKO.1 837 CDS 100% 2.160 1.512 N HOXA4 n/a
6 TRCN0000017507 GATCGCCCACACGCTCTGTTT pLKO.1 765 CDS 100% 1.650 1.155 N HOXA4 n/a
7 TRCN0000017503 GCAGAAGAAGACAGACCCTTT pLKO.1 1350 3UTR 100% 4.050 2.430 N HOXA4 n/a
8 TRCN0000016480 CGGAGGATGAAGTGGAAGAAA pLKO.1 820 CDS 100% 5.625 2.813 Y BARX1 n/a
9 TRCN0000070792 CCAACACCAAGATGCGATCTT pLKO.1 854 CDS 100% 4.950 3.465 N Hoxa4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002141.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.