Transcript: Human NM_002204.4

Homo sapiens integrin subunit alpha 3 (ITGA3), mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
ITGA3 (3675)
Length:
4889
CDS:
331..3486

Additional Resources:

NCBI RefSeq record:
NM_002204.4
NBCI Gene record:
ITGA3 (3675)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002204.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000057717 CATCGAGGATTACAGAGACTT pLKO.1 3144 CDS 100% 4.950 6.930 N ITGA3 n/a
2 TRCN0000057714 CCTCTATATTGGGTACACGAT pLKO.1 1071 CDS 100% 2.640 3.696 N ITGA3 n/a
3 TRCN0000438613 ACAGCAGAGACGTCCGGAAAT pLKO_005 2261 CDS 100% 10.800 8.640 N ITGA3 n/a
4 TRCN0000057716 CCAGGATGGATTTCAGGATAT pLKO.1 1470 CDS 100% 10.800 7.560 N ITGA3 n/a
5 TRCN0000057715 GACCTCGCTTAGCATGGTAAA pLKO.1 2613 CDS 100% 10.800 7.560 N ITGA3 n/a
6 TRCN0000435703 GACTTATCTGAGTATAGTTAC pLKO_005 1027 CDS 100% 10.800 7.560 N ITGA3 n/a
7 TRCN0000057713 CGGATGAACATCACAGTGAAA pLKO.1 643 CDS 100% 4.950 3.465 N ITGA3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002204.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.