Transcript: Human NM_002210.5

Homo sapiens integrin subunit alpha V (ITGAV), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
ITGAV (3685)
Length:
7039
CDS:
284..3430

Additional Resources:

NCBI RefSeq record:
NM_002210.5
NBCI Gene record:
ITGAV (3685)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002210.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000426214 TTGAAGTGTACCCTAGCATTT pLKO_005 1713 CDS 100% 10.800 15.120 N Itgav n/a
2 TRCN0000003239 GACTGAGCTAATCTTGAGAAT pLKO.1 5041 3UTR 100% 4.950 6.930 N ITGAV n/a
3 TRCN0000297280 GACTGAGCTAATCTTGAGAAT pLKO_005 5041 3UTR 100% 4.950 6.930 N ITGAV n/a
4 TRCN0000003241 CACTCCAAGAACATGACTATT pLKO.1 1934 CDS 100% 13.200 10.560 N ITGAV n/a
5 TRCN0000010768 GTGAGGTCGAAACAGGATAAA pLKO.1 665 CDS 100% 13.200 10.560 N ITGAV n/a
6 TRCN0000297281 GTGAGGTCGAAACAGGATAAA pLKO_005 665 CDS 100% 13.200 10.560 N ITGAV n/a
7 TRCN0000010769 CGACAGGCTCACATTCTACTT pLKO.1 2135 CDS 100% 4.950 3.960 N ITGAV n/a
8 TRCN0000342484 CGACAGGCTCACATTCTACTT pLKO_005 2135 CDS 100% 4.950 3.960 N ITGAV n/a
9 TRCN0000003240 CTCTGTTGTATATCCTTCATT pLKO.1 2793 CDS 100% 5.625 3.938 N ITGAV n/a
10 TRCN0000279970 CTCTGTTGTATATCCTTCATT pLKO_005 2793 CDS 100% 5.625 3.938 N ITGAV n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002210.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.