Transcript: Human NM_002285.3

Homo sapiens AF4/FMR2 family member 3 (AFF3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
AFF3 (3899)
Length:
9987
CDS:
252..3932

Additional Resources:

NCBI RefSeq record:
NM_002285.3
NBCI Gene record:
AFF3 (3899)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002285.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000108067 CCAGAACACTTTAGGCAATTA pLKO.1 458 CDS 100% 13.200 10.560 N AFF3 n/a
2 TRCN0000108068 GCTAAACGAATGAAGCATAAA pLKO.1 3201 CDS 100% 13.200 10.560 N AFF3 n/a
3 TRCN0000108065 CGGTGTAATATGTGGTGCAAT pLKO.1 5463 3UTR 100% 4.950 3.960 N AFF3 n/a
4 TRCN0000418735 AGGATGATGGCACGTTTAATT pLKO_005 373 CDS 100% 15.000 10.500 N AFF3 n/a
5 TRCN0000422072 TGAAGCAGCATTGTCGTTTAT pLKO_005 3266 CDS 100% 13.200 9.240 N AFF3 n/a
6 TRCN0000443698 AGCGTGCACTGCACATCATAC pLKO_005 1023 CDS 100% 10.800 7.560 N AFF3 n/a
7 TRCN0000086610 GCAGCTGGATAAATGGCTAAA pLKO.1 1649 CDS 100% 10.800 7.560 N Aff3 n/a
8 TRCN0000108069 CCACCACTTTCTGCTATTCAA pLKO.1 1188 CDS 100% 5.625 3.938 N AFF3 n/a
9 TRCN0000108066 CCACGCTGTAAAGTATTCAAA pLKO.1 3494 CDS 100% 5.625 3.938 N AFF3 n/a
10 TRCN0000086611 GCTGGATAAATGGCTAAACAA pLKO.1 1652 CDS 100% 5.625 3.938 N Aff3 n/a
11 TRCN0000166364 CACACACACACACACACACAA pLKO.1 4224 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002285.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.