Transcript: Human NM_002291.3

Homo sapiens laminin subunit beta 1 (LAMB1), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
LAMB1 (3912)
Length:
5650
CDS:
138..5498

Additional Resources:

NCBI RefSeq record:
NM_002291.3
NBCI Gene record:
LAMB1 (3912)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002291.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000083431 CCCAAGGATACAGAATTTATT pLKO.1 800 CDS 100% 15.000 12.000 N LAMB1 n/a
2 TRCN0000315627 CCCAAGGATACAGAATTTATT pLKO_005 800 CDS 100% 15.000 12.000 N LAMB1 n/a
3 TRCN0000083432 GCCCAAGGATACAGAATTTAT pLKO.1 799 CDS 100% 15.000 10.500 N LAMB1 n/a
4 TRCN0000083428 GCCTTAAACAACAGTTGCTTT pLKO.1 1686 CDS 100% 4.950 3.465 N LAMB1 n/a
5 TRCN0000333497 GCCTTAAACAACAGTTGCTTT pLKO_005 1686 CDS 100% 4.950 3.465 N LAMB1 n/a
6 TRCN0000083429 GCCTTTCTCAAGTAGAGGTTA pLKO.1 4795 CDS 100% 4.950 3.465 N LAMB1 n/a
7 TRCN0000315635 GCCTTTCTCAAGTAGAGGTTA pLKO_005 4795 CDS 100% 4.950 3.465 N LAMB1 n/a
8 TRCN0000083430 GCCTCAGGATACTTTGGCAAT pLKO.1 3012 CDS 100% 4.050 2.835 N LAMB1 n/a
9 TRCN0000315625 GCCTCAGGATACTTTGGCAAT pLKO_005 3012 CDS 100% 4.050 2.835 N LAMB1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002291.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.