Transcript: Human NM_002319.5

Homo sapiens leucine rich repeats and calponin homology domain containing 4 (LRCH4), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-08
Taxon:
Homo sapiens (human)
Gene:
LRCH4 (4034)
Length:
3177
CDS:
30..2081

Additional Resources:

NCBI RefSeq record:
NM_002319.5
NBCI Gene record:
LRCH4 (4034)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002319.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000235000 AGCAGCGACCACCCGAATTAA pLKO_005 1147 CDS 100% 15.000 21.000 N LRCH4 n/a
2 TRCN0000234998 GCCCTGCAGAGGATCTATTTC pLKO_005 877 CDS 100% 13.200 10.560 N LRCH4 n/a
3 TRCN0000234997 GCCTGAGCCTCTACCACAATT pLKO_005 313 CDS 100% 13.200 9.240 N LRCH4 n/a
4 TRCN0000235001 TCCAGATGAGAAGGACTTAAT pLKO_005 1631 CDS 100% 13.200 9.240 N LRCH4 n/a
5 TRCN0000234999 AGGCTTCCACAGCGTTGATAG pLKO_005 929 CDS 100% 10.800 7.560 N LRCH4 n/a
6 TRCN0000063929 CCGCCTGGATTTCTCCTGTAA pLKO.1 650 CDS 100% 4.950 3.465 N LRCH4 n/a
7 TRCN0000063932 GAGGAAGGATAGCCTCTTGAA pLKO.1 1313 CDS 100% 4.950 3.465 N LRCH4 n/a
8 TRCN0000063931 GAGGATCTATTTCCGGGACAT pLKO.1 885 CDS 100% 4.050 2.835 N LRCH4 n/a
9 TRCN0000063930 CTCGGAAGAATGTGGAGAGTT pLKO.1 1828 CDS 100% 4.950 2.970 N LRCH4 n/a
10 TRCN0000063928 GAGACCAAACAGCTTCCTCTT pLKO.1 1535 CDS 100% 4.050 2.430 N LRCH4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002319.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.