Transcript: Human NM_002333.4

Homo sapiens LDL receptor related protein 3 (LRP3), mRNA.

Source:
NCBI, updated 2019-05-01
Taxon:
Homo sapiens (human)
Gene:
LRP3 (4037)
Length:
4058
CDS:
457..2769

Additional Resources:

NCBI RefSeq record:
NM_002333.4
NBCI Gene record:
LRP3 (4037)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002333.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000310727 GCGACCGTGGTGACATGATTA pLKO_005 689 CDS 100% 13.200 18.480 N LRP3 n/a
2 TRCN0000303578 TCTCATCCGTGGTGACTATTT pLKO_005 3165 3UTR 100% 13.200 18.480 N LRP3 n/a
3 TRCN0000060822 TGACGACTACGTGCAGGTATA pLKO.1 1368 CDS 100% 10.800 15.120 N LRP3 n/a
4 TRCN0000315785 TGACGACTACGTGCAGGTATA pLKO_005 1368 CDS 100% 10.800 15.120 N LRP3 n/a
5 TRCN0000060820 CGTGGAGGACTTTCCTGTCTA pLKO.1 2148 CDS 100% 4.950 3.465 N LRP3 n/a
6 TRCN0000315865 CGTGGAGGACTTTCCTGTCTA pLKO_005 2148 CDS 100% 4.950 3.465 N LRP3 n/a
7 TRCN0000060819 TCTGTCTTACATCCGAGGGAA pLKO.1 915 CDS 100% 2.640 1.848 N LRP3 n/a
8 TRCN0000060821 GCCCGTGGACAAGGACAGAAA pLKO.1 2538 CDS 100% 1.650 1.155 N LRP3 n/a
9 TRCN0000315784 GCCCGTGGACAAGGACAGAAA pLKO_005 2538 CDS 100% 1.650 1.155 N LRP3 n/a
10 TRCN0000254603 CCAACTGCAGCTGGTACATTC pLKO_005 665 CDS 100% 10.800 7.560 N Lrp3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002333.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.