Transcript: Human NM_002336.3

Homo sapiens LDL receptor related protein 6 (LRP6), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
LRP6 (4040)
Length:
10252
CDS:
310..5151

Additional Resources:

NCBI RefSeq record:
NM_002336.3
NBCI Gene record:
LRP6 (4040)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002336.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000312743 ATGGGCCTAAAGGCTACAAAT pLKO_005 2035 CDS 100% 13.200 18.480 N LRP6 n/a
2 TRCN0000033404 CCGAATTTATTGGACTGATAT pLKO.1 2331 CDS 100% 13.200 18.480 N LRP6 n/a
3 TRCN0000033407 CCTGCCCACTACTCTCTTAAT pLKO.1 3058 CDS 100% 13.200 18.480 N LRP6 n/a
4 TRCN0000312687 CGATTGGTTGATGCTACAAAT pLKO_005 403 CDS 100% 13.200 18.480 N LRP6 n/a
5 TRCN0000033405 CGGCGAATTGAAAGCAGTGAT pLKO.1 3679 CDS 100% 4.950 6.930 N LRP6 n/a
6 TRCN0000109364 GCCATTAAACGAACAGAATTT pLKO.1 529 CDS 100% 13.200 9.240 N Lrp6 n/a
7 TRCN0000349750 TGGACCCTGCCGAAGGATTTA pLKO_005 2573 CDS 100% 13.200 9.240 N LRP6 n/a
8 TRCN0000033408 CCGATGCAATGGAGATGCAAA pLKO.1 4224 CDS 100% 4.950 3.465 N LRP6 n/a
9 TRCN0000327895 CCGATGCAATGGAGATGCAAA pLKO_005 4224 CDS 100% 4.950 3.465 N LRP6 n/a
10 TRCN0000033406 GCCGTTCATTTATAGATGGAT pLKO.1 1463 CDS 100% 3.000 2.100 N LRP6 n/a
11 TRCN0000349749 GATAGCCTTCAGTTAACTAAC pLKO_005 5595 3UTR 100% 10.800 6.480 N LRP6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002336.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.