Transcript: Human NM_002373.6

Homo sapiens microtubule associated protein 1A (MAP1A), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
MAP1A (4130)
Length:
10266
CDS:
468..8879

Additional Resources:

NCBI RefSeq record:
NM_002373.6
NBCI Gene record:
MAP1A (4130)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002373.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000116279 CCTGAGCAGGACAATAGGTAT pLKO.1 5493 CDS 100% 4.950 6.930 N MAP1A n/a
2 TRCN0000116277 GCACTGTCAAATGCTGGTATT pLKO.1 9151 3UTR 100% 10.800 7.560 N MAP1A n/a
3 TRCN0000116281 TGTGACAAACTTTCTTCCTTT pLKO.1 2970 CDS 100% 4.950 3.465 N MAP1A n/a
4 TRCN0000116280 CGGCATGATGAATACCTGGAA pLKO.1 7104 CDS 100% 2.640 1.848 N MAP1A n/a
5 TRCN0000116278 CCTCTGGCAAAGTCTATGGAA pLKO.1 2857 CDS 100% 3.000 1.800 N MAP1A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002373.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.