Transcript: Human NM_002395.6

Homo sapiens malic enzyme 1 (ME1), mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
ME1 (4199)
Length:
3338
CDS:
98..1816

Additional Resources:

NCBI RefSeq record:
NM_002395.6
NBCI Gene record:
ME1 (4199)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002395.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000064728 GCCTTCAATGAACGGCCTATT pLKO.1 1283 CDS 100% 10.800 15.120 N ME1 n/a
2 TRCN0000348925 TATGGCATGAATTGCCTTATT pLKO_005 803 CDS 100% 13.200 9.240 N Me1 n/a
3 TRCN0000064731 GCTTCCTTAACACAAGAGAAA pLKO.1 1130 CDS 100% 4.950 3.465 N ME1 n/a
4 TRCN0000064730 GCTGAGGTTATAGCTCAGCAA pLKO.1 1541 CDS 100% 0.264 0.185 N ME1 n/a
5 TRCN0000064729 CCAACAATATAGTTTGGTGTT pLKO.1 427 CDS 100% 4.050 2.430 N ME1 n/a
6 TRCN0000064732 CCTGTGGGTAAATTGGCTCTA pLKO.1 605 CDS 100% 4.050 2.430 N ME1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002395.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.